Journal: International Journal of Oncology

Article Title: Genome-wide transcriptional analysis of BRD4-regulated genes and pathways in human glioma U251 cells

doi: 10.3892/ijo.2018.4324

Figure Lengend Snippet: BRD4 knockdown attenuates the proliferation and promotes the apoptosis of U251 cells. (A) A Cell counting kit-8 assay was performed to detect the proliferation of U251 cells transduced with BRD4-shRNA or Scr-shRNA. Each experiment was performed in triplicate. (B) An EdU assay was performed to determine cell proliferation rates following BRD4 knockdown. Nuclei were counterstained blue with DAPI. Red indicates the cells undergoing proliferation. Scale bar, 20 µ m. (C) Quantification of the EdU assay results demonstrated that U251 cell proliferation was reduced following BRD4 knockdown. (D) Representative plots and quantification of flow cytometry analysis of apoptosis following BRD4 knockdown in U251 cells. Data are presented as the mean ± standard deviation of three independent experiments. ** P<0.01. BRD4, bromodomain containing 4; sh, short hairpin; Scr, scrambled control; OD, optical density.

Article Snippet: Scrambled shRNA (Scr-shRNA) that targeted a non-specific sequence (5′-TTCTCCGAACGTGTCACGT-3′) was used as the control. siRNA targeting KRAS proto-oncogene GTPase (KRAS) and the negative control siRNA (cat. nos. sc-35731 and sc-37007, respectively) were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA).

Techniques: Knockdown, Cell Counting, Transduction, shRNA, EdU Assay, Flow Cytometry, Standard Deviation, Control

Journal: International Journal of Oncology

Article Title: Genome-wide transcriptional analysis of BRD4-regulated genes and pathways in human glioma U251 cells

doi: 10.3892/ijo.2018.4324

Figure Lengend Snippet: Ten key genes identified by global signal transduction network analysis.

Article Snippet: Scrambled shRNA (Scr-shRNA) that targeted a non-specific sequence (5′-TTCTCCGAACGTGTCACGT-3′) was used as the control. siRNA targeting KRAS proto-oncogene GTPase (KRAS) and the negative control siRNA (cat. nos. sc-35731 and sc-37007, respectively) were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA).

Techniques: Transduction

Journal: International Journal of Oncology

Article Title: Genome-wide transcriptional analysis of BRD4-regulated genes and pathways in human glioma U251 cells

doi: 10.3892/ijo.2018.4324

Figure Lengend Snippet: Experimental validation of microarray results. (A) Reverse transcription-quantitative polymerase chain reaction results for the mRNA expression levels of the ten key genes identified by global signal transduction network analysis. (B) Western blotting validation of the protein expression changes of key genes in the BRD4-shRNA and the Scr-shRNA groups. GAPDH was used as an internal control. (C) Representative photographs and quantification of KRAS immunostaining in normal brain tissue and glioma tissues of grades II, III and IV. Scale bar, 20 µ m. (D) Western blot analysis of KRAS levels in HA and U251 cells. (E) KRAS silencing following siRNA transfection in U251 cells was confirmed by western blotting (at 72 h post-transfection). (F) A cell counting kit-8 assay was performed to detect the proliferation rates of siKRAS and or siCon-transfected U251 cells. Each experiment was performed in triplicate. (G) The apoptosis rates of siKRAS and siCon-transfected U251 cells were determined by TUNEL staining (red). Nuclei were counterstained with DAPI (blue). Scar bar, 50 µ m. Experimental data are presented as the mean ± standard deviation of at least three experiments. * P<0.05 and ** P<0.01. BRD4, bromodomain containing 4; sh, short hairpin; Scr, scrambled control; KRAS, KRAS proto-oncogene GTPase; HA, human astrocytes; si, small interfering; Con, control; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labelling; OD, optical density.

Article Snippet: Scrambled shRNA (Scr-shRNA) that targeted a non-specific sequence (5′-TTCTCCGAACGTGTCACGT-3′) was used as the control. siRNA targeting KRAS proto-oncogene GTPase (KRAS) and the negative control siRNA (cat. nos. sc-35731 and sc-37007, respectively) were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA).

Techniques: Biomarker Discovery, Microarray, Reverse Transcription, Real-time Polymerase Chain Reaction, Expressing, Transduction, Western Blot, shRNA, Control, Immunostaining, Transfection, Cell Counting, TUNEL Assay, Staining, Standard Deviation

Journal: Experimental and Therapeutic Medicine

Article Title: MUC21 induces the viability and migration of glioblastoma via the STAT3/AKT pathway

doi: 10.3892/etm.2022.11260

Figure Lengend Snippet: Relationship between MUC21 expression and clinicopathological characteristics of patients with glioblastoma (n=47).

Article Snippet: MUC21 short hairpin RNA (shRNA; sequence: 5'-GGGTCAGCATAGTCACCAACT-3' and 5'-GCGCTCTGACATGCAGAA-3') and negative control shRNA (shNC; sequence: 5'-TTCTCCGAACGTGTCACGT-3') plasmids were purchased from Santa Cruz Biotechnology, Inc. and transfected into both U251 and U87 cells using Lipofectamine ® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.). shNC was used as a control to compare with MUC21 shRNA (1 μg) transfection. pcDNA3.1-MUC21 was used for overexpression assays and the pcDNA3.1-vector (Addgene, Inc.) was used as control.

Techniques: Expressing

Journal: Experimental and Therapeutic Medicine

Article Title: MUC21 induces the viability and migration of glioblastoma via the STAT3/AKT pathway

doi: 10.3892/etm.2022.11260

Figure Lengend Snippet: MUC21 is highly expressed in human GBM tissues. (A) A reverse transcription-quantitative PCR assay were conducted to determine the mRNA levels of MUC21 in GBM and corresponding adjacent non-cancerous tissues. A paired Student's t-test was used for the analysis of tumor and adjacent non-tumor samples. (B) Western blotting was performed to determine MUC21 expression in three GBM cell lines. (C) Immunohistochemistry was performed to evaluate the protein levels of MUC21 in GBM tumor and corresponding adjacent non-cancerous tissues. Magnification, x100 and x200 (scale bar, 5 mm). * P<0.05 as indicated. GBM glioblastoma; MUC21, mucin 21.

Article Snippet: MUC21 short hairpin RNA (shRNA; sequence: 5'-GGGTCAGCATAGTCACCAACT-3' and 5'-GCGCTCTGACATGCAGAA-3') and negative control shRNA (shNC; sequence: 5'-TTCTCCGAACGTGTCACGT-3') plasmids were purchased from Santa Cruz Biotechnology, Inc. and transfected into both U251 and U87 cells using Lipofectamine ® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.). shNC was used as a control to compare with MUC21 shRNA (1 μg) transfection. pcDNA3.1-MUC21 was used for overexpression assays and the pcDNA3.1-vector (Addgene, Inc.) was used as control.

Techniques: Reverse Transcription, Real-time Polymerase Chain Reaction, Western Blot, Expressing, Immunohistochemistry

Journal: Experimental and Therapeutic Medicine

Article Title: MUC21 induces the viability and migration of glioblastoma via the STAT3/AKT pathway

doi: 10.3892/etm.2022.11260

Figure Lengend Snippet: MUC21 expression is downregulated in U251 and U87 cells after MUC21 shRNA transfection. (A) Reverse transcription-quantitative PCR assays were performed to measure MUC21 mRNA levels in U251 and U87 cells following control or MUC21 shRNA transfection. (B) Western blot analysis was performed to determine the protein expression of MUC21 in U251 and U87 cells following control or MUC21 shRNA transfection. * P<0.05 vs. shRNA. MUC21, mucin 21; NC, negative control; shRNA, short hairpin RNA.

Article Snippet: MUC21 short hairpin RNA (shRNA; sequence: 5'-GGGTCAGCATAGTCACCAACT-3' and 5'-GCGCTCTGACATGCAGAA-3') and negative control shRNA (shNC; sequence: 5'-TTCTCCGAACGTGTCACGT-3') plasmids were purchased from Santa Cruz Biotechnology, Inc. and transfected into both U251 and U87 cells using Lipofectamine ® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.). shNC was used as a control to compare with MUC21 shRNA (1 μg) transfection. pcDNA3.1-MUC21 was used for overexpression assays and the pcDNA3.1-vector (Addgene, Inc.) was used as control.

Techniques: Expressing, shRNA, Transfection, Reverse Transcription, Real-time Polymerase Chain Reaction, Control, Western Blot, Negative Control

Journal: Experimental and Therapeutic Medicine

Article Title: MUC21 induces the viability and migration of glioblastoma via the STAT3/AKT pathway

doi: 10.3892/etm.2022.11260

Figure Lengend Snippet: MUC21 promotes GBM cell viability and migration in vitro . (A) Cell viability was assessed after MUC21 depletion in U87 and U251 through colony formation assays. (B) MTT assays were performed to detect the viability of cells transfected with the indicated shRNA. (C) Wound closure assay of GBM cells transfected with the indicated shRNA were performed for the quantification of migrated cells after 24 h. Magnification, x200. Western blotting assays were performed to analyze the expression of (D) Ki-67 and PCNA, and (E) MMP2 and MMP9 in GBM cells transfected with the indicated shRNA. Relative expression was analyzed. * P<0.05 and ** P<0.01 vs. the shNC group. GBM glioblastoma; MUC21, mucin 21; PCNA, proliferating cell nuclear antigen; shRNA, short hairpin RNA; NC, negative control.

Article Snippet: MUC21 short hairpin RNA (shRNA; sequence: 5'-GGGTCAGCATAGTCACCAACT-3' and 5'-GCGCTCTGACATGCAGAA-3') and negative control shRNA (shNC; sequence: 5'-TTCTCCGAACGTGTCACGT-3') plasmids were purchased from Santa Cruz Biotechnology, Inc. and transfected into both U251 and U87 cells using Lipofectamine ® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.). shNC was used as a control to compare with MUC21 shRNA (1 μg) transfection. pcDNA3.1-MUC21 was used for overexpression assays and the pcDNA3.1-vector (Addgene, Inc.) was used as control.

Techniques: Migration, In Vitro, Transfection, shRNA, Wound Closure Assay, Western Blot, Expressing, Negative Control

Journal: Experimental and Therapeutic Medicine

Article Title: MUC21 induces the viability and migration of glioblastoma via the STAT3/AKT pathway

doi: 10.3892/etm.2022.11260

Figure Lengend Snippet: MUC21 contributes to GBM progression via the STAT3 and AKT signaling pathway. (A) The protein levels of p-STAT3, STAT3, p-AKT and AKT in shMUC21-transfected or control U251 cells were detected by immunoblot assays. (B) The protein levels of MUC21, p-STAT3, STAT3, p-AKT and AKT in MUC21-overexpressing or control U251 cells were detected by immunoblot assays. The relative expression was analyzed. * P<0.05 and ** P<0.01 vs. shNC or Con. Con, control; MUC21, mucin 21; NC, negative control; p-, phosphorylated; shRNA, short hairpin RNA.

Article Snippet: MUC21 short hairpin RNA (shRNA; sequence: 5'-GGGTCAGCATAGTCACCAACT-3' and 5'-GCGCTCTGACATGCAGAA-3') and negative control shRNA (shNC; sequence: 5'-TTCTCCGAACGTGTCACGT-3') plasmids were purchased from Santa Cruz Biotechnology, Inc. and transfected into both U251 and U87 cells using Lipofectamine ® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.). shNC was used as a control to compare with MUC21 shRNA (1 μg) transfection. pcDNA3.1-MUC21 was used for overexpression assays and the pcDNA3.1-vector (Addgene, Inc.) was used as control.

Techniques: Transfection, Control, Western Blot, Expressing, Negative Control, shRNA

Journal: Experimental and Therapeutic Medicine

Article Title: MUC21 induces the viability and migration of glioblastoma via the STAT3/AKT pathway

doi: 10.3892/etm.2022.11260

Figure Lengend Snippet: MUC21 stimulates glioblastoma progression through the STAT3 and AKT pathway in vivo . (A) U251 cells stably transfected with control or MUC21 shRNA vectors were subcutaneously implanted into nude mice. Tumor volume was monitored every week. Isolated tumors were displayed in (A). Tumor growth curves were compared between control and MUC21 depletion groups. Murine weight was also measured. (B) An immunohistochemistry assay was conducted to assess MUC21 protein levels in control or MUC21-depleted groups (scale bar, 200 µm). (C) Western blotting assays were performed to assess the expression levels of the indicated proteins in control or MUC21-depleted tumor tissues isolated from nude mice. * P<0.05 and ** P<0.01 vs. shNC. MUC21, mucin 21; NC, negative control; PCNA, proliferating cell nuclear antigen; p-, phosphorylated; shRNA, short hairpin RNA.

Article Snippet: MUC21 short hairpin RNA (shRNA; sequence: 5'-GGGTCAGCATAGTCACCAACT-3' and 5'-GCGCTCTGACATGCAGAA-3') and negative control shRNA (shNC; sequence: 5'-TTCTCCGAACGTGTCACGT-3') plasmids were purchased from Santa Cruz Biotechnology, Inc. and transfected into both U251 and U87 cells using Lipofectamine ® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.). shNC was used as a control to compare with MUC21 shRNA (1 μg) transfection. pcDNA3.1-MUC21 was used for overexpression assays and the pcDNA3.1-vector (Addgene, Inc.) was used as control.

Techniques: In Vivo, Stable Transfection, Transfection, Control, shRNA, Isolation, Immunohistochemistry, Western Blot, Expressing, Negative Control

Journal: iScience

Article Title: High glucose impairs cognitive function through inducing mitochondrial calcium overload in Treg cells

doi: 10.1016/j.isci.2023.108689

Figure Lengend Snippet: SP1-mediated HDAC2 recruitment and histone deacetylation lead to NCLX downregulation and Treg cell function impairment under high glucose conditions (A) Identification of the transcription factors predicted to associate with the promoter of NCLX (SLC8B1), as determined by PROMO software. A total of 11 transcription factors were identified (upper panel). Correlation analysis of NCLX (SLC8B1) with SP1 (bottom left panel), YY1 (bottom middle panel), and CEBPB (bottom right panel). (B) Relative expression of NCLX mRNA after SP1, CEBPB, or YY1 overexpression in human Treg cells, as detected by RT-PCR. (C) Binding of SP1 to the NCLX promoter in Treg cells isolated from control subjects and type 2 diabetic patients with MCI. (D) Levels of histone H3 lysine acetylation (ac-H3) on the NCLX promoter in Treg cells isolated from control subjects and type 2 diabetic patients with MCI. (E) Treg cells isolated from control subjects and type 2 diabetic patients with MCI were used for IP assay with anti-SP1 antibodies and control normal IgG and analyzed using IB as indicated. (F and G) mRNA level of NCLX (F) and quantification analysis of protein level of NCLX (G) in human Treg cells treated with or without HDAC inhibitor Santacruzamate A (CAY10683) in the presence of high glucose (HG, 25 mmol/L D-glucose). (H) Levels of histone H3 lysine acetylation (ac-H3) on the NCLX promoter in human Treg cells treated with high glucose (HG, 25 mmol/L D-glucose) in the presence of control siRNA or SP1 siRNA for 72 h. (I) Binding of SP1 to the NCLX promoter in human Treg cells treated with high glucose (HG, 25 mmol/L D-glucose) in the presence of control siRNA or SP1 siRNA for 72 h. (J) Human Treg cells treated with control siRNA or SP1 siRNA in the presence of high glucose (HG, 25 mmol/L D-glucose) were used for IP assay with anti-SP1 antibodies and control normal IgG and analyzed using IB as indicated. (K–O) Flow cytometry analysis of mitochondrial calcium levels (K), mtROS levels (L), MPTP opening (M), MMP (N), and apoptosis levels (O) in human Treg cells treated with SP1 siRNA or control siRNA in the presence of high glucose (HG, 25 mmol/L D-glucose). (P) Representative images for CD86 and CD206 in microglia cocultured with high glucose (HG, 25 mmol/L D-glucose)-treated Treg cells in the presence of control siRNA or SP1 siRNA for 72 h. (Q) Flow cytometry analysis of apoptosis in primary hippocampal neurons cocultured with microglia under different treatment. [Samples: (1) HG + siCtr, (2) HG + siSP1]. Quantitative data show percentage of cell death rates.

Article Snippet: SP1 siRNA and shRNA Plasmids (h) , Santa Cruz Biotechnology , Cat# sc-29487.

Techniques: Cell Function Assay, Software, Expressing, Over Expression, Reverse Transcription Polymerase Chain Reaction, Binding Assay, Isolation, Control, Flow Cytometry

Journal: iScience

Article Title: High glucose impairs cognitive function through inducing mitochondrial calcium overload in Treg cells

doi: 10.1016/j.isci.2023.108689

Figure Lengend Snippet: Increasing O-GlcNAcylation of SP1 at S491A contributes to high-glucose-induced effects in Treg cells (A) Immunoblots analysis of protein level of O-GlcNAcylation in human Treg cells treated with normal glucose (NG, 5.5 mmol/L D-glucose) or high glucose (HG, 25 mmol/L D-glucose). (B) Immunoblot analysis of protein level of O-GlcNAcylation in Treg cells isolated from control subjects and type 2 diabetic patients with MCI. (C–I) mRNA level of NCLX (C), quantification analysis of protein level of NCLX (D), flow cytometry analysis of mitochondrial calcium levels (E), mtROS levels (F), MPTP opening (G), MMP (H), and apoptosis levels (I) in human Treg cells treated with or without OGT inhibitors OSMI-1 (30 μM) in the presence of high glucose (HG, 25 mmol/L D-glucose). (J) Representative images for CD86 and CD206 in microglia cocultured with high-glucose (HG, 25 mmol/L D-glucose)-treated Treg cells in the presence or absence of OSMI-1 (30 μM) for 24 h. (K) Flow cytometry analysis of apoptosis in primary hippocampal neurons cocultured with microglia under different treatment. [Samples: (1) HG + vehicle, (2) HG + OSMI-1]. Quantitative data show percentage of cell death rates. (L–P) Flow cytometry analysis of mitochondrial calcium levels (L), mtROS levels (M), MPTP opening (N), MMP (O), and apoptosis levels (P) in human Treg cells treated with control siRNA or OGT siRNA in the presence of high glucose (HG, 25 mmol/L D-glucose). (Q) Representative images for CD86 and CD206 in microglia cocultured with high-glucose (HG, 25 mmol/L D-glucose)-treated Treg cells in the presence of control siRNA or OGT siRNA. (R) Flow cytometry analysis of apoptosis in primary hippocampal neurons cocultured with microglia under different treatment. [Samples: (1) HG + siCtr, (2) HG + siOGT]. Quantitative data show percentage of cell death rates. (S) The interaction between OGT and SP1 in human Treg cells was detected by immunoprecipitation and western blot. (T) Lysates from human Treg cells treated with high glucose (HG, 25 mmol/L D-glucose) in the presence of control siRNA or OGT siRNA for 72 h were subjected to IP with either control normal IgG or anti-SP1, followed by IB with the indicated antibodies. (U) Lysates from human Treg cells infected with OGT-overexpressing lentivirus or control lentivirus for 72 h were subjected to IP with either control normal IgG or anti-SP1, followed by IB with the indicated antibodies. (V) HEK293T cells were transfected with Flag-SP1 in the presence or absence of HA-HDAC2 as indicated. After incubation with normal glucose (NG, 5.5 mmol/L D-glucose) or high glucose (HG, 25 mmol/L D-glucose), cells were lysed for precipitated protein detection by Co-immunoprecipitation assay with anti-Flag beads and western blot with indicated antibodies. (W) HEK293T cells were transfected with Flag-SP1 in the presence or absence of HA-HDAC2 as indicated. After overnight incubation with or without OSMI-1 (30 μM) in the presence of high glucose (HG, 25 mmol/L D-glucose), cells were lysed for precipitated protein detection by Co-immunoprecipitation assay with anti-Flag beads and western blot with indicated antibodies. (X) HEK293T cells were transfected with Flag-SP1 in the presence or absence of HA-HDAC2 as indicated. After 72 h incubation with control siRNA or OGT siRNA in the presence of high glucose (HG, 25 mmol/L D-glucose), cells were lysed for precipitated protein detection by Co-immunoprecipitation assay with anti-FLAG beads and western blot with indicated antibodies. (Y) Lysates from human Treg cells treated with or without OSMI-1 (30 μM) in the presence of high glucose (HG, 25 mmol/L D-glucose) were subjected to IP with either control normal IgG or anti-SP1, followed by IB with the indicated antibodies. (Z) Lysates from human Treg cells treated with high glucose (HG, 25 mmol/L D-glucose) in the presence of control siRNA or OGT siRNA for 72 h were subjected to IP with either control normal IgG or anti-SP1, followed by IB with the indicated antibodies.

Article Snippet: SP1 siRNA and shRNA Plasmids (h) , Santa Cruz Biotechnology , Cat# sc-29487.

Techniques: Western Blot, Isolation, Control, Flow Cytometry, Immunoprecipitation, Infection, Transfection, Incubation, Co-Immunoprecipitation Assay

Journal: iScience

Article Title: High glucose impairs cognitive function through inducing mitochondrial calcium overload in Treg cells

doi: 10.1016/j.isci.2023.108689

Figure Lengend Snippet: Increasing O-GlcNAcylation of SP1 at S491A contributes to high-glucose-induced effects in Treg cells (A) O-glycosylation sites were predicted using YinOYang 1.2, NetOGlyc 4.0, and the O-GlcNAc database (v1.2). (B) Endogenous SP1 was depleted in HEK293T cells by short RNA (shRNA), followed by stable reconstitution with cDNAs encoding WT or O-GlcNAcylation-deficient mutants of SP1 (S421A, S491A, S507A), and SP1 O-GlcNAcylation was analyzed by immunoprecipitation with anti-FLAG antibody and western blot with the indicated antibodies. (C) Endogenous SP1 was depleted in high-glucose (HG, 25 mmol/L D-glucose)- treated human Treg cells by short RNA (shRNA), followed by stable reconstitution with cDNAs encoding WT or O-GlcNAcylation-deficient mutants of SP1 (S491A), and SP1 O-GlcNAcylation was analyzed by immunoprecipitation with anti-FLAG antibody and western blot with the indicated antibodies. (D–J) mRNA level of NCLX (D), quantification analysis of protein level of NCLX (E), flow cytometry analysis of mitochondrial calcium levels (F), mtROS levels (G), MPTP opening (H), MMP (I), and apoptosis levels (J) in human SP1-KD Treg cells under different treatment. [Samples: (1) HG + WT, (2) HG + SP1 S491A]. (K) Cross-species sequence alignment of SP1. (L–R) mRNA level of NCLX (L), quantification analysis of protein level of NCLX (M), flow cytometry analysis of mitochondrial calcium levels (N), mtROS levels (O), MPTP opening (P), MMP (Q), and apoptosis levels (R) in SP1-KD mouse Treg cells under different treatment. [Samples: (1) HG + WT, (2) HG + SP1 S493A]. (S) Representative images for CD86 and CD206 in microglia cocultured with SP1-KD Treg cells under different treatment. [Samples: (1) HG + WT, (2) HG + SP1 S493A]. (T) Flow cytometry analysis of apoptosis in primary hippocampal neurons cocultured with microglia under different treatment. [Samples: (1) HG + WT, (2) HG + SP1 S493A]. Quantitative data show percentage of cell death rates.

Article Snippet: SP1 siRNA and shRNA Plasmids (h) , Santa Cruz Biotechnology , Cat# sc-29487.

Techniques: Glycoproteomics, shRNA, Immunoprecipitation, Western Blot, Flow Cytometry, Sequencing

Journal: iScience

Article Title: High glucose impairs cognitive function through inducing mitochondrial calcium overload in Treg cells

doi: 10.1016/j.isci.2023.108689

Figure Lengend Snippet: Glucagon-like peptide-1 (GLP-1) receptor agonist protects against high-glucose-induced Treg cell dysfunction and cognitive impairment through inhibiting SP1 O-GlcNAcylation (A–F) Immunoblots and quantification analysis of protein level of NCLX (A), flow cytometry analysis of mitochondrial calcium levels (B), mtROS levels (C), MPTP opening (D), MMP (E), and apoptosis levels (F) in Treg cells isolated from db/db + vehicle and db/db + liraglutide mice. (G and H) Immunoblots and quantification analysis of protein levels of CD86, CD206 (G) and BAX, Bcl-2 (H) in the hippocampus of db/db + vehicle and db/db + liraglutide mice. (I) Morris water maze behavioral assessment for db/db + vehicle or db/db + liraglutide mice showing differences in path (left), escape latency (second from left), number of times mice passed through the platform location in the probe trial (second from right), and the time mice stayed in the target quadrant (right) during learning session. (J–N) Flow cytometry analysis of mitochondrial calcium levels (J), mtROS levels (K), MPTP opening (L), MMP (M), and apoptosis levels (N) in human Treg cells treated with or without liraglutide (100 nM) in the presence of high glucose (HG, 25 mmol/L D-glucose). (O) Lysates from Treg cells isolated from type 2 diabetic patients with MCI before and after liraglutide treatment were subjected to IP with either control normal IgG or anti-SP1, followed by IB with the indicated antibodies. (P) Binding of SP1 to the NCLX promoter in Treg cells isolated from type 2 diabetic patients with MCI before and after liraglutide treatment. (Q) Levels of histone H3 lysine acetylation (ac-H3) on the NCLX promoter in Treg cells isolated from type 2 diabetic patients with MCI before and after liraglutide treatment. (R and S) mRNA level of NCLX (R) and quantification analysis of protein level of NCLX (S) in Treg cells isolated from type 2 diabetic patients with MCI before and after liraglutide treatment. (T) Lysates from Treg cells isolated from db/db + shGLP1R + vehicle and db/db + shGLP1R + liraglutide mice were subjected to IP with either control normal IgG or anti-SP1, followed by IB with the indicated antibodies. (U) Binding of SP1 to the NCLX promoter in Treg cells isolated from db/db + shGLP1R + vehicle and db/db + shGLP1R + liraglutide mice. (V) Levels of histone H3 lysine acetylation (ac-H3) on the NCLX promoter in Treg cells isolated from db/db + shGLP1R and db/db + shGLP1R + liraglutide mice. (W and X) Flow cytometry analysis of mitochondrial calcium levels (W) and mtROS levels (X) in Treg cells isolated from db/db + shGLP1R + vehicle and db/db + shGLP1R + liraglutide mice. (Y) Immunoblots and quantification analysis of protein levels of CD86 and CD206 in the hippocampus of db/db + shGLP1R + vehicle and db/db + shGLP1R + liraglutide mice. (Z) Morris water maze behavioral assessment for db/db + shGLP1R + vehicle and db/db + shGLP1R + liraglutide mice showing differences in path (left), escape latency (second from left), number of times mice passed through the platform location in the probe trial (second from right), and the time mice stayed in the target quadrant (right) during learning session.

Article Snippet: SP1 siRNA and shRNA Plasmids (h) , Santa Cruz Biotechnology , Cat# sc-29487.

Techniques: Western Blot, Flow Cytometry, Isolation, Control, Binding Assay

Journal: iScience

Article Title: High glucose impairs cognitive function through inducing mitochondrial calcium overload in Treg cells

doi: 10.1016/j.isci.2023.108689

Figure Lengend Snippet: GLP-1 receptor agonist alleviates high-glucose-induced effects via GLP-1-receptor-mediated upregulation of OGA in Treg cells (A and B) mRNA levels of OGT, OGA (A) and quantification analysis of protein level of OGA (B) in Treg cells isolated from type 2 diabetic patients with MCI before and after liraglutide treatment. (C and D) mRNA levels of OGT, OGA (C) and quantification analysis of protein level of OGA (D) in human Treg cells treated with or without liraglutide (100 nM) in the presence of high glucose (HG, 25 mmol/L D-glucose). (E) Lysates from human Treg cells treated with control siRNA or OGA siRNA in the presence of high glucose (HG, 25 mmol/L D-glucose) and liraglutide (100 nM) were subjected to IP with either control normal IgG or anti-SP1, followed by IB with the indicated antibodies. (F) Binding of SP1 to the NCLX promoter in human Treg cells treated with control siRNA or OGA siRNA in the presence of high glucose (HG, 25 mmol/L D-glucose) and liraglutide (100 nM). (G) Levels of histone H3 lysine acetylation (ac-H3) on the NCLX promoter in human Treg cells treated with control siRNA or OGA siRNA in the presence of high glucose (HG, 25 mmol/L D-glucose) and liraglutide (100 nM). (H–N) mRNA levels of NCLX (H), quantification analysis of protein levels of NCLX (I), flow cytometry analysis of mitochondrial calcium levels (J), mtROS levels (K), MPTP opening (L), MMP (M), and apoptosis levels (N) in human Treg cells treated with control siRNA or OGA siRNA in the presence of high glucose (HG, 25 mmol/L D-glucose) and liraglutide (100 nM). (O) Double immunofluorescence demonstrates co-localization of GLP1 and GLP1R in human Treg cells; arrowheads indicate the co-localization of GLP1 and GLP1R (scale bar, 10 μm). (P) The interaction between GLP1 and GLP1R in human Treg cells was detected by immunoprecipitation and western blot. (Q) Immunoblots analysis of protein level of GLP1R in Treg cells isolated from db/db Foxp3 Cre−ERT2 and db/db Foxp3 Cre−ERT2 GLP1R fl/fl mice. (R) Lysates from Treg cells isolated from db/db Foxp3 Cre−ERT2 + liraglutide and db/db Foxp3 Cre−ERT2 GLP1R fl/fl + liraglutide mice were subjected to IP with either control normal IgG or anti-SP1, followed by IB with the indicated antibodies. (S) Binding of SP1 to the NCLX promoter in Treg cells isolated from db/db Foxp3 Cre−ERT2 + liraglutide and db/db Foxp3 Cre−ERT2 GLP1R fl/fl + liraglutide mice. (T) Levels of histone H3 lysine acetylation (ac-H3) on the NCLX promoter in Treg cells isolated from db/db Foxp3 Cre−ERT2 + liraglutide and db/db Foxp3 Cre−ERT2 GLP1R fl/fl + liraglutide mice. (U–W) Flow cytometry analysis of mitochondrial calcium levels (U), mtROS levels (V), and quantification analysis of protein levels of CD86, CD206 (W) in Treg cells isolated from db/db Foxp3 Cre−ERT2 + liraglutide and db/db Foxp3 Cre−ERT2 GLP1R fl/fl + liraglutide mice. (X) Morris water maze behavioral assessment for db/db Foxp3 Cre−ERT2 + liraglutide and db/db Foxp3 Cre−ERT2 GLP1R fl/fl + liraglutide mice showing differences in path (left), escape latency (second from left), number of times mice passed through the platform location in the probe trial (second from right), and the time mice stayed in the target quadrant (right) during learning session.

Article Snippet: SP1 siRNA and shRNA Plasmids (h) , Santa Cruz Biotechnology , Cat# sc-29487.

Techniques: Isolation, Control, Binding Assay, Flow Cytometry, Immunofluorescence, Immunoprecipitation, Western Blot

Journal: iScience

Article Title: High glucose impairs cognitive function through inducing mitochondrial calcium overload in Treg cells

doi: 10.1016/j.isci.2023.108689

Figure Lengend Snippet:

Article Snippet: SP1 siRNA and shRNA Plasmids (h) , Santa Cruz Biotechnology , Cat# sc-29487.

Techniques: Recombinant, SYBR Green Assay, Staining, Immunofluorescence, Blocking Assay, Western Blot, Transfection, Cell Culture, ATP Assay, Luciferase, Reporter Gene Assay, Membrane, TUNEL Assay, Apoptosis Assay, Bicinchoninic Acid Protein Assay, Cell Isolation, shRNA, Software

Journal: Oncology Reports

Article Title: Small interfering RNA targeting of Recepteur d'Origine Nantais induces apoptosis via modulation of nuclear factor-κB and Bcl-2 family in gastric cancer cells

doi: 10.3892/or_00000911

Figure Lengend Snippet: Figure 1. RON siRNA reduces RON expression and cell survival. MKN28 cells were transfected with siRNAs against RON for 3 and 6 days, and the mRNA and protein levels of RON were determined by RT-PCR (A) and Western blot analysis (B). (C) Cells were transfected with scrambled (S) or RON siRNA (si) for 3 and 6 days, and cell viability was determined by an MTT assay. The number of viable cells in the well is expressed as mean ± SD.

Article Snippet: Gene silencing was performed using scrambled (sc-37007) and human RON sequence-specific duplex siRNA (sc-36434; Santa Cruz Biotechnology, Santa Cruz, CA, USA).

Techniques: Expressing, Transfection, Reverse Transcription Polymerase Chain Reaction, Western Blot, MTT Assay

Journal: Oncology Reports

Article Title: Small interfering RNA targeting of Recepteur d'Origine Nantais induces apoptosis via modulation of nuclear factor-κB and Bcl-2 family in gastric cancer cells

doi: 10.3892/or_00000911

Figure Lengend Snippet: Figure 2. The induction of apoptosis by RON siRNA. (A) MKN28 cells were transfected with RON siRNA for 3 and 6 days, and fixed in paraformaldehyde. The DNA was stained using bis-benzimide (Hoechst 33342) to show the presence of nuclear fragmentation and chromatin condensation. (B) Flow cytometric histograms of cells transfected with RON siRNA for 3 and 6 days. The vertical axes (counts) represent the number of cells and the horizonal axes (Annexin-Y FITC) represent the labeling with annexin V. (C) The cells transfected with RON siRNA for 3 and 6 days. The level of the DNA fragmentation was analyzed by electrophoresis in a 1.5% agarose gel.

Article Snippet: Gene silencing was performed using scrambled (sc-37007) and human RON sequence-specific duplex siRNA (sc-36434; Santa Cruz Biotechnology, Santa Cruz, CA, USA).

Techniques: Transfection, Staining, Labeling, Electrophoresis, Agarose Gel Electrophoresis

Journal: Oncology Reports

Article Title: Small interfering RNA targeting of Recepteur d'Origine Nantais induces apoptosis via modulation of nuclear factor-κB and Bcl-2 family in gastric cancer cells

doi: 10.3892/or_00000911

Figure Lengend Snippet: Figure 3. The effects of RON siRNA on the expression of the Bcl-2 family and the activity of NF-κB. (A) After the transfection of the MKN28 cells with RON siRNA for 3 and 6 days, Western blot analyses were performed with the cell lysates using anti-Bax and Bcl-2 antibodies. (B) Nuclear extracts from the cells were analyzed by EMSA for the activated NF-κB using a radiolabeled oligonucleotide probe. (C) RON siRNA-induced a decrease in the level of the p65 subunit of NF-κB. Protein (50 μg) from the above nuclear lysates were subjected to SDS-PAGE and Western blotting using the NF-κB (p65 subunit) antibody.

Article Snippet: Gene silencing was performed using scrambled (sc-37007) and human RON sequence-specific duplex siRNA (sc-36434; Santa Cruz Biotechnology, Santa Cruz, CA, USA).

Techniques: Expressing, Activity Assay, Transfection, Western Blot, SDS Page

Journal: Oncology Reports

Article Title: Small interfering RNA targeting of Recepteur d'Origine Nantais induces apoptosis via modulation of nuclear factor-κB and Bcl-2 family in gastric cancer cells

doi: 10.3892/or_00000911

Figure Lengend Snippet: Figure 4. RON siRNA causes the cytochrome c release and caspase activation in cells. (A) After transfection of the MKN28 cells with RON siRNA for 3 and 6 days, Western blot analysis was performed with the cell lysates using the anti-cytochrome c antibody. (B) Caspase-8 and -9 activities were determined using a specific fluorogenic peptide substrate as described in Materials and methods.

Article Snippet: Gene silencing was performed using scrambled (sc-37007) and human RON sequence-specific duplex siRNA (sc-36434; Santa Cruz Biotechnology, Santa Cruz, CA, USA).

Techniques: Activation Assay, Transfection, Western Blot

Journal: Scientific Reports

Article Title: A20 regulates IL-1-induced tolerant production of CXC chemokines in human mesangial cells via inhibition of MAPK signaling

doi: 10.1038/srep18007

Figure Lengend Snippet: ( a ) A20 protein levels in Mock- and A20-transfected cell clones. HMC cells were mock-tranfected, or transfected with A20 mammalian expressing plasmid, G418-resistant clones were selected and A20 (82 KD) protein levels were detected by western blot. GAPDH (36KD) protein levels were detected as loading controls. ( b ) The effect of A20 over-expression on IL-1β-induced mRNA expression of CXCLs. Mock- and A20-transfected cells were treated with the indicated concentrations of IL-1β for 1 h. The mRNA levels of CXCL1, 2, and 8 were detected by RT-PCR. GAPDH mRNA levels were detected as loading controls. ( c ) The quantitative data for ( b ). ( d ) The effect of A20 over-expression on IL-1β-induced protein expression of CXCLs. Mock- and A20-transfected cells were treated with the indicated concentrations of IL-1β for 6 h. The protein levels of CXCL1, 2, and 8 in the culture supernatant were detected by western blot. GAPDH protein levels were detected as loading controls. ( e ) The effect of A20 over-expression on IL-1α-induced mRNA expression of CXCLs. p-value *< 0.05, and **< 0.01 compared with mock-transfected groups. ( f ) The effect of A20 transient transfection on A20 expression. Cells were transfected with indicated A20 mammalian expression plasmid. 48 h after transfection, the expression levels of A20 were detected by western blot. GAPDH protein levels were detected as loading controls. ( g ) The effect of A20 transient transfection on IL-1β-induced chemokine expression. Cells were transiently transfected with indicated A20 mammalian expression plasmid. 48 h after transfection, the cells were treated with 5 ng/ml IL-1β for 1 h. CXCL1, 2, and 8 mRNA levels were detected by qRT-PCR. p-value *< 0.05, and **< 0.01 compared with non-transfected, IL-1β-treated groups.

Article Snippet: siRNA against human A20 (sc-37655) and silencer negative siRNA control (sc-37007) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). siRNA transfection reagent (sc-29528, Santa Cruz, CA, USA) was used to transfect siRNA into HMC cells according to the manufacturer’s instructions.

Techniques: Transfection, Clone Assay, Expressing, Plasmid Preparation, Western Blot, Over Expression, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR

Journal: Scientific Reports

Article Title: A20 regulates IL-1-induced tolerant production of CXC chemokines in human mesangial cells via inhibition of MAPK signaling

doi: 10.1038/srep18007

Figure Lengend Snippet: HMC cells, tranfected with the indicated concentration of A20 siRNA (A20si), or with control siRNA (Ctrsi) for 5 h, were cultured for 12 h, followed by the pre-treatment with 5 ng/ml IL-1β for 24 h, and then a treatment with IL-1β for 2 h for A20 protein detection ( a ), for 1 h for chemokine mRNA detection ( b ), and for 6 h for chemokine protein detection ( c ). p-value *< 0.05, compared with non-transfected, IL-1β-pre-treated groups.

Article Snippet: siRNA against human A20 (sc-37655) and silencer negative siRNA control (sc-37007) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). siRNA transfection reagent (sc-29528, Santa Cruz, CA, USA) was used to transfect siRNA into HMC cells according to the manufacturer’s instructions.

Techniques: Concentration Assay, Control, Cell Culture, Transfection

Journal: Scientific Reports

Article Title: A20 regulates IL-1-induced tolerant production of CXC chemokines in human mesangial cells via inhibition of MAPK signaling

doi: 10.1038/srep18007

Figure Lengend Snippet: ( a ) Dose dependent regulation of A20, IRAK1 and TRAF6 protein levels by IL-1β. HMC cells were treated with the indicated concentrations of IL-1β for 2 h. The protein levels of A20 (82 KD), IRAK1 (78 KD), and TRAF6 (60 KD) were detected by western blot. GAPDH (36 KD) protein levels were detected as loading controls. ( b ) Time-dependent regulation of A20, IRAK1, and TRAF6 protein levels by IL-1β. ( c ) Dose-dependent regulation of IRAK1 and TRAF6 mRNA levels by IL-1β. ( d ) Time dependent regulation of A20, IRAK1 and TRAF6 protein levels by IL-1α. ( e ) The effect of A20 over-expression on the protein levels of A20, IRAK1 and TRAF6. HMC cells, transfected with 2 μg plasmid containing the sequence coding for human A20 protein, or with empty plasmid, G418-resistant clones were selected for the detection of A20, IRAK1, and TRAF6 expression by western blot. GAPDH protein levels were detected as loading controls. ( f ) The effect of A20 down-regulation on the protein levels of A20, IRAK1, and TRAF6. HMC cells, transfected with the indicated concentrations of A20 siRNA, or control siRNA, for 5 h, were cultured for 36 h, followed by the treatment with 5 ng/ml IL-1β for 2 h. The protein levels of A20, IRAK1, and TRAF6 were detected by western blot. GAPDH protein levels were detected as loading controls.

Article Snippet: siRNA against human A20 (sc-37655) and silencer negative siRNA control (sc-37007) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). siRNA transfection reagent (sc-29528, Santa Cruz, CA, USA) was used to transfect siRNA into HMC cells according to the manufacturer’s instructions.

Techniques: Western Blot, Over Expression, Transfection, Plasmid Preparation, Sequencing, Clone Assay, Expressing, Control, Cell Culture

Journal: eLife

Article Title: Intrinsic OXPHOS limitations underlie cellular bioenergetics in leukemia

doi: 10.7554/eLife.63104

Figure Lengend Snippet: ( A ) Log2 Abundance of TRAP1 in PBMC and leukemia cells. ( B ) Comparison of OXPHOS kinetics in presence of the TRAP1 inhibitor, 17-AAG (15 µM); n = 4 independent cell experiments. Comparison of ( C ) Fractional OXPHOS and ( D ) FCCP Effect in MV-4–11 cells treated with DMSO or 17-AAG (15 µM). ( E ) Comparison of respiratory flux inhibition within MV-4–11 cells across a range of ΔG ATP in the absence and presence of 17-AAG (15 µM). Respiration was stimulated by the addition of FCCP (1 µM), followed by PCR titration to manipulate ΔG ATP . ( F ) Relative abundance of TRAP1 mRNA following shRNA knockdown of TRAP1 in MV-4–11 cells. ( G ) Basal respiration in intact cells. ( H ) OXPHOS kinetics in permeabilized MV-4–11 cells infected with lentivirus encoding shRNA targeted to TRAP1 (TRAP1 KD) or scrambled shRNA (Control). ( I–J ) Fractional OXPHOS and FCCP Effect measured in the presence of vehicle (DMSO), 17-AAG (15 µM), or gamitrinib (1 µM) in control and TRAP1 KD cells. ( K ) OXPHOS kinetics in permeabilized MV-4–11 cells in the presence of DMSO or curcumin (10–20 µM). FCCP Effect is graphed to the right. ( L ) Schematic depicting the presumed mechanism of action of 17-AAG, gamitrinib and curcumin in which the compounds selectively block ATP uptake via the VDAC-ANT axis to restore OXPHOS kinetics. ( M ) Cell proliferation expressed as a percentage of Control. ( N ) Cell viability in MV-4–11 cells infected with lentivirus encoding shRNA targeted to TRAP1 or scrambled shRNA and treated for 24 hr with increasing concentrations of Ara-C. Additional treatments included gamitrinib (1 µM), 17-AAG (15 µM) or curcumin (10–20 µM) either alone or plus Ara-C (20 µM). Data depicted as viability based on the percentage of vehicle using the propidium iodide assay. ( A ) n = 4/6/group; ( B–D ) n = 4 independent experiments; ( E–K ) n = 3 independent experiments; ( M ) n = 8 independent experiments; ( N ) n = 4–6 independent experiments. Data are presented as mean ± SEM analyzed by unpaired t-tests ( F–H, M ) two-way ANOVA ( B, K ), one-way ANOVA ( A, I, J, N ), paired t-tests ( B–E ). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Figure 6—source data 1. Raw values for ' ' and ' '.

Article Snippet: Human shRNA lentiviral particles packaged from pGFP-C-shLenti vector (4 unique 29mer TRAP1-specific shRNA [ ACAGCCGCAAAGTCCTCATCCAGACCAAG ; ATGGTGGCTGACAGAGTGGAGGTCTATTC ; GGAGACGGACATAGTCGTGGATCACTACA ; TGGCTTTCAGATGGTTCTGGAGTGTTTGA ], one scramble control; 0.5 ml each,>10^7 TU/ml) were purchased from Origene (CAT#: TL300868V).

Techniques: Comparison, Inhibition, Titration, shRNA, Knockdown, Infection, Control, Blocking Assay

Journal: eLife

Article Title: Intrinsic OXPHOS limitations underlie cellular bioenergetics in leukemia

doi: 10.7554/eLife.63104

Figure Lengend Snippet: ( A ) Comparison of FCCP-stimulated respiration with the addition of 17-AAG (15 µM) in permeabilized MV-4–11 cells; n = 3 independent experiments. ( B–D ) OXPHOS kinetics in permeabilized HL-60 cells in the presence of DMSO or 17-AAG (15 µM); n = 3 independent experiments. ( E–F ) OXPHOS kinetics in permeabilized MV-4–11 or KG-1 cells in the presence of DMSO or 17-AAG (15 µM). Cell were energized with either CI (Pyr/M) or CII linked substrates (S/R); n = 3 independent experiments. ( G ) Schematic of changes in ATP, ADP, PCR, and CR concentrations across a range of ΔG ATP. ( H ) Inhibition of respiration by antimycin A (ANT) across a range of ΔG ATP in permeabilized HL-60 cells; n = 3 independent experiments. ( I–J ) Comparison of respiratory flux inhibition within permeabilized AML cells across a range of ΔG ATP induced by functional TRAP1. Respiration was stimulated by the addition of FCCP (1 µM), followed by PCR titration to manipulate ΔG ATP ; n = 3 independent experiments. ( K ) ETS capacity assay in permeabilized MV-4–11 cells infected with lentivirus encoding shRNA targeted to TRAP1 (TRAP1 KD) or scrambled shRNA (Control); n = 3 independent experiments. ( L ) Comparison of OXPHOS kinetics in the presence of DMSO, 17-AAG (15 µM), or gamitrinib (1 µM) in Control and TRAP1 KD cells. Data depicted as a percentage of basal respiration based on oxygen consumption rates obtained prior to digitonin permeabilization; n = 3 independent experiments. Data are presented as mean ± SEM and analyzed by paired t-tests ( A–F, H–J ) or unpaired t-tests ( K–L ). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

Article Snippet: Human shRNA lentiviral particles packaged from pGFP-C-shLenti vector (4 unique 29mer TRAP1-specific shRNA [ ACAGCCGCAAAGTCCTCATCCAGACCAAG ; ATGGTGGCTGACAGAGTGGAGGTCTATTC ; GGAGACGGACATAGTCGTGGATCACTACA ; TGGCTTTCAGATGGTTCTGGAGTGTTTGA ], one scramble control; 0.5 ml each,>10^7 TU/ml) were purchased from Origene (CAT#: TL300868V).

Techniques: Comparison, Inhibition, Functional Assay, Titration, Infection, shRNA, Control

Journal: eLife

Article Title: Intrinsic OXPHOS limitations underlie cellular bioenergetics in leukemia

doi: 10.7554/eLife.63104

Figure Lengend Snippet:

Article Snippet: Human shRNA lentiviral particles packaged from pGFP-C-shLenti vector (4 unique 29mer TRAP1-specific shRNA [ ACAGCCGCAAAGTCCTCATCCAGACCAAG ; ATGGTGGCTGACAGAGTGGAGGTCTATTC ; GGAGACGGACATAGTCGTGGATCACTACA ; TGGCTTTCAGATGGTTCTGGAGTGTTTGA ], one scramble control; 0.5 ml each,>10^7 TU/ml) were purchased from Origene (CAT#: TL300868V).

Techniques: Isolation, Lysis, Transfection, Construct, shRNA, Plasmid Preparation, Sequencing, Recombinant, Reverse Transcription, Software

Journal: Oncology Letters

Article Title: Effect of alkylglycerone phosphate synthase on the expression profile of circRNAs in the human thyroid cancer cell line FRO

doi: 10.3892/ol.2018.8356

Figure Lengend Snippet: Primer sequences.

Article Snippet: FRO cells were cultured in a 6-well plate for 24 h, and then transfected with an AGPS short hairpin (sh)RNA plasmid (sc-94310-SH; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) (AGPS sh group) or with an AGPS clustered regularly interspaced short palindromic repeats-associated protein-9 nuclease knockout (KO) plasmid (sc-404604; Santa Cruz Biotechnology, Inc.) (AGPS KO group), according to the manufacturer's protocol.

Techniques: Sequencing

Journal: Oncology Letters

Article Title: Effect of alkylglycerone phosphate synthase on the expression profile of circRNAs in the human thyroid cancer cell line FRO

doi: 10.3892/ol.2018.8356

Figure Lengend Snippet: Expression of AGPS in thyroid cancer cell lines. AGPS expression in the thyroid cancer cell lines TPC-1, FTC-133 and FRO was evaluated using reverse transcription-quantitative polymerase chain reaction analysis. *P<0.05 vs. TPC-1. AGPS, alkylglycerone phosphate synthase.

Article Snippet: FRO cells were cultured in a 6-well plate for 24 h, and then transfected with an AGPS short hairpin (sh)RNA plasmid (sc-94310-SH; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) (AGPS sh group) or with an AGPS clustered regularly interspaced short palindromic repeats-associated protein-9 nuclease knockout (KO) plasmid (sc-404604; Santa Cruz Biotechnology, Inc.) (AGPS KO group), according to the manufacturer's protocol.

Techniques: Expressing, Reverse Transcription, Real-time Polymerase Chain Reaction

Journal: Oncology Letters

Article Title: Effect of alkylglycerone phosphate synthase on the expression profile of circRNAs in the human thyroid cancer cell line FRO

doi: 10.3892/ol.2018.8356

Figure Lengend Snippet: Heatmap of circRNA expression data. The different expressions of circRNAs were depicted in the heatmap. Green represents a decreased expression of circRNAs and red represents an increased expression of circRNAs. Cluster analysis demonstrated that AGPS sh and AGPS KO could induce the alteration in circRNAs expression in FRO cells. circRNA, circular RNA; AGPS, alkylglycerone phosphate synthase; sh, short hairpin; KO, knockout.

Article Snippet: FRO cells were cultured in a 6-well plate for 24 h, and then transfected with an AGPS short hairpin (sh)RNA plasmid (sc-94310-SH; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) (AGPS sh group) or with an AGPS clustered regularly interspaced short palindromic repeats-associated protein-9 nuclease knockout (KO) plasmid (sc-404604; Santa Cruz Biotechnology, Inc.) (AGPS KO group), according to the manufacturer's protocol.

Techniques: Expressing, Knock-Out

Journal: Oncology Letters

Article Title: Effect of alkylglycerone phosphate synthase on the expression profile of circRNAs in the human thyroid cancer cell line FRO

doi: 10.3892/ol.2018.8356

Figure Lengend Snippet: Comparison of differentially expressed circRNAs. (A) Differentially expressed circRNAs among the different groups were identified by scatter plots. The orange points represent >2-fold upregulation, whereas the blue points represent >2-fold downregulation. (B) Differences in circRNA expression among the three groups. circRNA, circular RNA; AGPS, alkylglycerone phosphate synthase; sh, short hairpin; KO, knockout.

Article Snippet: FRO cells were cultured in a 6-well plate for 24 h, and then transfected with an AGPS short hairpin (sh)RNA plasmid (sc-94310-SH; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) (AGPS sh group) or with an AGPS clustered regularly interspaced short palindromic repeats-associated protein-9 nuclease knockout (KO) plasmid (sc-404604; Santa Cruz Biotechnology, Inc.) (AGPS KO group), according to the manufacturer's protocol.

Techniques: Comparison, Expressing, Knock-Out

Journal: Oncology Letters

Article Title: Effect of alkylglycerone phosphate synthase on the expression profile of circRNAs in the human thyroid cancer cell line FRO

doi: 10.3892/ol.2018.8356

Figure Lengend Snippet: Venn diagrams of differentially expressed circular RNAs in the three groups. The Venn diagrams represent the shared modified genes between groups: AGPS_sh vs. control; AGPS_KO vs. control; and AGPS_sh vs. AGPS_KO, in FRO cell lines. AGPS, alkylglycerone phosphate synthase; sh, short hairpin; KO, knockout.

Article Snippet: FRO cells were cultured in a 6-well plate for 24 h, and then transfected with an AGPS short hairpin (sh)RNA plasmid (sc-94310-SH; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) (AGPS sh group) or with an AGPS clustered regularly interspaced short palindromic repeats-associated protein-9 nuclease knockout (KO) plasmid (sc-404604; Santa Cruz Biotechnology, Inc.) (AGPS KO group), according to the manufacturer's protocol.

Techniques: Modification, Control, Knock-Out

Journal: Oncology Letters

Article Title: Effect of alkylglycerone phosphate synthase on the expression profile of circRNAs in the human thyroid cancer cell line FRO

doi: 10.3892/ol.2018.8356

Figure Lengend Snippet: Top 50 differentially expressed circRNAs in AGPS sh and AGPS KO human thyroid cancer FRO cells.

Article Snippet: FRO cells were cultured in a 6-well plate for 24 h, and then transfected with an AGPS short hairpin (sh)RNA plasmid (sc-94310-SH; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) (AGPS sh group) or with an AGPS clustered regularly interspaced short palindromic repeats-associated protein-9 nuclease knockout (KO) plasmid (sc-404604; Santa Cruz Biotechnology, Inc.) (AGPS KO group), according to the manufacturer's protocol.

Techniques: Control

Journal: Oncology Letters

Article Title: Effect of alkylglycerone phosphate synthase on the expression profile of circRNAs in the human thyroid cancer cell line FRO

doi: 10.3892/ol.2018.8356

Figure Lengend Snippet: Validation of differentially expressed circRNAs using RT-qPCR. The top 10 circRNAs with increased and decreased expression in the AGPS KO group compared with the control group by RT-qPCR were identified. *P<0.05 vs. control. circRNA, circular RNA; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; AGPS, alkylglycerone phosphate synthase; sh, short hairpin; KO, knockout; hsa, Homo sapiens .

Article Snippet: FRO cells were cultured in a 6-well plate for 24 h, and then transfected with an AGPS short hairpin (sh)RNA plasmid (sc-94310-SH; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) (AGPS sh group) or with an AGPS clustered regularly interspaced short palindromic repeats-associated protein-9 nuclease knockout (KO) plasmid (sc-404604; Santa Cruz Biotechnology, Inc.) (AGPS KO group), according to the manufacturer's protocol.

Techniques: Biomarker Discovery, Quantitative RT-PCR, Expressing, Control, Reverse Transcription, Real-time Polymerase Chain Reaction, Knock-Out

Journal: Oncology Letters

Article Title: Effect of alkylglycerone phosphate synthase on the expression profile of circRNAs in the human thyroid cancer cell line FRO

doi: 10.3892/ol.2018.8356

Figure Lengend Snippet: GO analysis of AGPS silencing in thyroid cancer FRO cells. GO analysis was performed on the up- and downregulated genes identified in the AGPS sh, AGPS KO and control thyroid cancer FRO cells. The y-axis represented gene ontology entries, the x-axis represented -log10 (P-value). -log10 (P-value) >2 was considered to indicate a significant threshold. (A) Upregulation and (B) downregulation of MF, BP and CC by GO analysis of AGPS silencing in FRO cells compared with control thyroid cancer FRO cells. (C) Upregulation and (D) downregulation of MF, BP and CC by GO analysis of AGPS silencing in FRO cells compared with AGPS KO in thyroid cancer FRO cells. (E) Upregulation and (F) downregulation of MF, BP and CC by GO analysis of AGPS KO compared with control thyroid cancer FRO cells. GO, Gene Ontology; AGPS, alkylglycerone phosphate synthase; sh, short hairpin; KO, knockout; MF, molecular function; BP, biological process; CC, cellular component.

Article Snippet: FRO cells were cultured in a 6-well plate for 24 h, and then transfected with an AGPS short hairpin (sh)RNA plasmid (sc-94310-SH; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) (AGPS sh group) or with an AGPS clustered regularly interspaced short palindromic repeats-associated protein-9 nuclease knockout (KO) plasmid (sc-404604; Santa Cruz Biotechnology, Inc.) (AGPS KO group), according to the manufacturer's protocol.

Techniques: Control, Knock-Out

Journal: Oncology Letters

Article Title: Effect of alkylglycerone phosphate synthase on the expression profile of circRNAs in the human thyroid cancer cell line FRO

doi: 10.3892/ol.2018.8356

Figure Lengend Snippet: KEGG pathway enrichment analysis of AGPS silencing in thyroid cancer FRO cells. KEGG pathway enrichment analysis is represented by histograms and scatter diagrams. Orange represents the pathway of upregulation gene enrichment, whereas blue represents the downregulated pathway of gene enrichment. The left and right sides of the scatter diagrams correspond to the downregulated and upregulated gene enrichment pathways, respectively. The x-axes represent the proportion of enriched genes, whereas the y-axes contain the name of the KEGG pathway. If up- or downregulated genes were enriched in a certain pathway, this pathway was represented as a point in the graph, the color of which indicated a significant P-value, whereas its size represented the number of differentially expressed genes in that particular pathway. Effect of regulatory function and signaling pathway by KEGG pathway enrichment analysis of AGPS silencing compared with (A) control and (B) KO thyroid cancer FRO cells. (C) Effect of regulatory function and signaling pathway by KEGG pathway enrichment analysis of AGPS KO compared with control thyroid cancer FRO cells. KEGG, Kyoto Encyclopedia of Genes and Genomes; AGPS, alkylglycerone phosphate synthase; KO, knockout; hsa, Homo sapiens .

Article Snippet: FRO cells were cultured in a 6-well plate for 24 h, and then transfected with an AGPS short hairpin (sh)RNA plasmid (sc-94310-SH; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) (AGPS sh group) or with an AGPS clustered regularly interspaced short palindromic repeats-associated protein-9 nuclease knockout (KO) plasmid (sc-404604; Santa Cruz Biotechnology, Inc.) (AGPS KO group), according to the manufacturer's protocol.

Techniques: Control, Knock-Out